doctor head
 
  pharmacy and drugs  
search Search
 
       About us       News      A-Z Drugs      Stores      Top Drugs      Contact  
  doctor doctor hand
 
  doctor legs  
 
 
 
 

  Diseases

  Newsletter
Subscribe to our newsletter:
Name:
E-mail:
    Search results
Search results for: hydrochloride

1 - 5 of 81 <<previous | next>>

Drugs results:

Levitra tablets

Levitra

Levitra is one of a group of medicines that delay enzymes called phosphodiesterases from working too quickly, and is used to treat men who have erectile dysfunction. By controlling these enzymes, Levitra helps men maintain an erection. Levitra is also more...

Meridia

Meridia

Meridia, or Sibutramine, is used together with a reduced-calorie diet to help you lose weight and to help keep the lost weight from returning. Meridia is thought to work by increasing the activity of norepinephrine and serotonin in th more...

Paxil tablets

Paxil

Paxil is used to treat mental depression, obsessive-compulsive disorder, panic disorder, generalized anxiety disorder, social anxiety disorder, premenstrual dysphoric disorder (PMDD), and posttraumatic stress disorder (PTSD). more...

Tramadol

Tramadol

Tramadol, also called Ultram, is an analgesic used to relieve pain, including use after surgery. The effects of Tramadol are similar to those of narcotic analgesics, and though it is not considered narcotic, it may become habit forming. Be sure to tel more...

Ultram tablet

Ultram

Ultram, also called Tramadol, is an analgesic used to relieve pain, including use after surgery. The effects of Ultram are similar to those of narcotic analgesics, and though it is not considered narcotic, it may become habit forming. Be sure to tell more...

Diseases results:

Erectile dysfunction
Obesity
Obsessive compulsive disorder
Pain relief
Wilsons disease

Articles results:

Committee For Orphan Medicinal Products, January 2007 Meeting, Europe
The seventy-fifth meeting of the Committee for Orphan Medicinal Products (COMP) took place on 9-10 January 2007. The Committee was delighted to officially welcome two COMP members from the new Member States. An updated list of COMP membership is provided in Annex 1 (below).


Seventy-seventh Meeting Of The Committee For Orphan Medicinal Products (COMP) Took Place On 7-8 March 2007 - Europe
COMP OpinionsThe Committee adopted 4 positive opinions on orphan medicinal product designation during this meeting:-- Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT), from Gene Signal SAS, for prevention of corneal graft rejection (review time: day 88)


FDA Announces That Companies Must Stop Marketing Suppository Products Containing Trimethobenzamide
As part of the Food and Drug Administration's (FDA) on-going initiative to ensure that all marketed U.S. drugs have required marketing approval, the agency announced today that companies must stop manufacturing and distributing unapproved suppository drug products containing trimethobenzamide hydrochloride. These products are used to treat nausea and vomiting in adults and children. Drugs containing trimethobenzamide in suppository form lack evidence of effectiveness.


Change Suicide Warning On Antidepressants FDA Asks Drug Makers
The US Food and Drug Administration (FDA) has asked makers of all antidepressant drugs to change the existing "black box" labels on their products to warn about increased risk of suicidality (suicidal thinking and behaviour) among young adults aged 18 to 24 in the first few weeks of treatment.


Ranbaxy Receives Tentative FDA Approval For Fexofenadine Hydrochloride Tablets
Ranbaxy Pharmaceuticals Inc. (RPI), a wholly owned subsidiary of Ranbaxy Laboratories Limited (RLL), announced today that RLL has received tentative approval from the U.S. Food and Drug Administration to manufacture and market the antihistamine Fexofenadine Hydrochloride Tablets, 30 mg, 60 mg, and 180 mg. Total annual market sales for Fexofenadine Hydrochloride Tablets were $931 million (IMS - MAT: March 2007).




1 - 5 of 81 <<previous | next>>

© 2006-2010 pharmacy-and-drugs.com. All rights reserved.