doctor head
 
  pharmacy and drugs  
search Search
 
       About us       News      A-Z Drugs      Stores      Top Drugs      Contact  
  doctor doctor hand
 
  doctor legs  
 
 
 
 

  Diseases

  Newsletter
Subscribe to our newsletter:
Name:
E-mail:
    Search results
Search results for: chlor

1 - 5 of 196 <<previous | next>>

Drugs results:

Ativan tablets

Ativan

Ativan, known also as Lorazepam, is a Benzodiazepine that belongs to the group of medicines called central nervous system (CNS) depressants. Ativan is used as an Amnestic, Antianxiety Agent, Anticonvulsant, Antiemetic in Cancer Chemotherapy, Antipanic Age more...

Diazepam tablets

Diazepam

Diazepam, one of a group of drugs known as Benzodiazepines, is a Central Nervous System (CNS) depressant. Diazepam is used as an Amnestic, an Anitanxiety Agent, Anticonvulsant, an Antipanic and Antitremor Agent, a Sedative, and Muscle Relaxant. It is used more...

Levitra tablets

Levitra

Levitra is one of a group of medicines that delay enzymes called phosphodiesterases from working too quickly, and is used to treat men who have erectile dysfunction. By controlling these enzymes, Levitra helps men maintain an erection. Levitra is also more...

Meridia

Meridia

Meridia, or Sibutramine, is used together with a reduced-calorie diet to help you lose weight and to help keep the lost weight from returning. Meridia is thought to work by increasing the activity of norepinephrine and serotonin in th more...

Paxil tablets

Paxil

Paxil is used to treat mental depression, obsessive-compulsive disorder, panic disorder, generalized anxiety disorder, social anxiety disorder, premenstrual dysphoric disorder (PMDD), and posttraumatic stress disorder (PTSD). more...

Diseases results:

Mental Health and Depression
Status epilepticus
Erectile dysfunction
Obesity
Obsessive compulsive disorder
Schizophrenia
Digestive system
Stomach ulcer
Hay fever
Hives

Articles results:

Novartis Highlights Strong R&D Pipeline, Plans For Multiple New Product Launches And Novel Projects Moving Into Late-stage Trials
Novartis unveiled today new data on its promising pipeline amid plans for multiple new product approvals and launches over the next two years. Many of these anticipated approvals are for potentially best-in-class medicines that would advance treatment standards for patients with hypertension, diabetes, cancer and other diseases.


Committee For Orphan Medicinal Products, January 2007 Meeting, Europe
The seventy-fifth meeting of the Committee for Orphan Medicinal Products (COMP) took place on 9-10 January 2007. The Committee was delighted to officially welcome two COMP members from the new Member States. An updated list of COMP membership is provided in Annex 1 (below).


Seventy-seventh Meeting Of The Committee For Orphan Medicinal Products (COMP) Took Place On 7-8 March 2007 - Europe
COMP OpinionsThe Committee adopted 4 positive opinions on orphan medicinal product designation during this meeting:-- Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT), from Gene Signal SAS, for prevention of corneal graft rejection (review time: day 88)


Meeting Highlights From The Committee For Medicinal Products For Human Use, 19-22 March 2007, Europe
Positive opinion for Revlimid The Committee for Medicinal Products for Human Use (CHMP) has adopted a positive opinion for Revlimid (lenalidomide), from Celgene Europe, for the treatment of multiple myeloma. EMEA review began on 29 March 2006, with an active review time of 199 days. The active substance of Revlimid, lenalidomide, has a chemical structure that resembles that of thalidomide.


FDA Announces That Companies Must Stop Marketing Suppository Products Containing Trimethobenzamide
As part of the Food and Drug Administration's (FDA) on-going initiative to ensure that all marketed U.S. drugs have required marketing approval, the agency announced today that companies must stop manufacturing and distributing unapproved suppository drug products containing trimethobenzamide hydrochloride. These products are used to treat nausea and vomiting in adults and children. Drugs containing trimethobenzamide in suppository form lack evidence of effectiveness.




1 - 5 of 196 <<previous | next>>

© 2006-2010 pharmacy-and-drugs.com. All rights reserved.